Compartilhar
Informação da revista
Compartilhar
Compartilhar
Baixar PDF
Mais opções do artigo
Visitas
...
Caso Clínico
DOI: 10.1016/j.abdp.2020.06.002
Open Access
Disponível online o 4 Agosto 2020
Tratamento bem‐sucedido de um paciente com coinfecção cutânea causada por infecção por Mucor irregularis e Klebsiella pneumoniae
Visitas
...
Siping Zhanga, Kunju Zhub, Chi Zhanga,
Autor para correspondência
zcwill@163.com

Autor para correspondência.
a Departamento de Dermatologia e Venereologia, Primeiro Hospital Afiliado de USTC, Universidade de Ciência e Tecnologia da China, Hefei, China
b Instituto do Departamento de Pesquisa em Medicina Clínica, Primeiro Hospital Afiliado, Universidade de Jinan, Guangdong, China
Recebido 29 Agosto 2019. Aceitado 20 Março 2020
Informação do artigo
Resume
Texto Completo
Bibliografia
Baixar PDF
Estatísticas
Figuras (4)
Mostrar maisMostrar menos
Resumo

Os autores relatam um caso raro de mucormicose cutânea primária causada por infecções por Mucor irregularis e Klebsiella pneumoniae em uma mulher chinesa de 67 anos. Após a administração de anfotericina B lipossômica combinada com cefoperazona/sulbactam sódico, a paciente se recuperou. A combinação de infecção fúngica invasiva e infecção bacteriana cutânea merece atenção.

Palavras‐chave:
Anfotericina B
Klebsiella pneumoniae
Mucormicose
Texto Completo
Introdução

A mucormicose é uma infecção fúngica invasiva rara, com mortalidade extremamente alta e poucas opções terapêuticas, é frequentemente observada em pacientes imunocomprometidos. Muitas espécies pertencentes à ordem Mucorales podem causar mucormicose, mas a mucormicose causada por Mucor irregularis (anteriormente Rhizomucor variabilis) é extremamente rara. Os autores descrevem um caso de infecção por Mucor irregularis de progressão lenta na face, acompanhada por infecção cutânea por Klebsiella pneumoniae.

Relato do caso

Uma mulher de 67 anos apresentava histórico de nove anos de lesão avermelhada na face após uma ferida perfurante curada na pálpebra esquerda. Ela apresentava febre, desidratação, vômitos e dores no corpo na primeira consulta. O exame cutâneo evidenciou uma úlcera com secreção purulenta central amarela e uma crosta dura, seca e escura na testa e na bochecha direita, circundadas por uma borda elevada sem inclinação e um anel inflamatório. Observou‐se uma placa irregular, confluente, infiltrada e vermelho‐clara com um limite claro que acometia nariz, bochecha esquerda e pálpebras. Uma grande crosta necrótica de coloração vermelho‐acastanhada cobria a maior parte das lesões. A paciente relatou que coceira, dor e demais sintomas pioravam ao pressionar a ferida. Os linfonodos submandibulares e cervicais eram palpáveis (fig. 1).

Figura 1.

Antes do tratamento. Paciente do sexo feminino de 67 anos apresentou uma úlcera com secreção purulenta central amarela e uma crosta dura, seca e escura na testa e bochecha direita, circundada por uma borda elevada sem inclinação e um anel inflamatório. Uma placa irregular, confluente, infiltrada e vermelho‐clara com um limite claro acometia o nariz, bochecha esquerda e pálpebras. Uma grande crosta necrótica de coloração vermelho‐acastanhada cobria a maior parte das lesões.

(0,16MB).

O hemograma completo indicou anemia leve. As tomografias computadorizadas (TC) simples e com contraste mostraram uma sombra em partes moles, sem uma borda distinta. Os ossos craniofaciais estavam intactos. O exame histopatológico da biópsia tecidual com coloração pela hematoxilina e eosina (H&E) revelou hifas não septadas em forma de fita, características de um fungo da ordem Mucorales, circundadas por células gigantes multinucleadas (fig. 2). A cultura bacteriana indicou a presença do fenótipo selvagem resistente de K. pneumoniae. O exame microscópico de material obtido da cultura revelou esporângios esféricos, hifas longas e hialinas e rizoides sem estolões distintos (fig. 3). As identificações biomoleculares foram confirmadas pelo sequenciamento de nucleotídeos da região do espaçador interno transcrito (ITS; sequência primer: ITS1 5’‐TCCGTAGGTGAACCTGCGG‐3’, ITS4 5’‐TCCTCCGCTTATTGATATGC‐3’) e pesquisa de similaridade de sequência que usou o BLAST no banco de dados do National Center for Biotechnology Information (NCBI). Uma pesquisa BLAST no banco de dados NCBI GenBank apontou que o patógeno isolado era 99% homólogo ao M. irregularis (acesso GenBank N° EF583637).

Figura 2.

Hifas não septadas em forma de fita, características de um fungo da ordem Mucorales, circundadas por células gigantes multinucleadas (seta amarela; Hematoxilina & eosina, 400×).

(0,27MB).
Figura 3.

Achados microbiológicos. A microscopia de material da cultura revelou esporângios esféricos, hifas longas e hialinas e rizoides sem estolões distintos (400×).

(0,06MB).

Adotou‐se um tratamento intravenoso com anfotericina B (AnB) combinada com cefoperazona/sulbactam sódica, de acordo com um teste de suscetibilidade a medicamentos. O tratamento com AnB foi iniciado com uma dose diária de 1mg, progrediu gradualmente para uma dose diária máxima de 40mg. Após uma semana, a úlcera superficial tornou‐se mais seca, com a formação de novo tecido de granulação; a crosta necrótica caiu e as secreções purulentas desapareceram. No entanto, os efeitos colaterais apareceram gradualmente: febre alta, coriza, dor muscular, dor de cabeça e vômitos, bem como hipocalemia e hipoproteinemia insuportavelmente graves. A função renal começou a deteriorar‐se levemente. Assim, a AnB foi substituída por AnB lipossômica, que foi mais eficaz e apresenta menos efeitos colaterais no tratamento de infecções fúngicas invasivas.1 Com o alívio dos efeitos colaterais, a lesão se resolveu gradualmente. A pesquisa de fungos na lesão cutânea produziu resultados negativos (fig. 4). Quando a dose total atingiu 1,5g, o tratamento com AnB foi interrompido e substituído por itraconazol oral (400mg por dia) por dois meses. Não foi observada recorrência durante os três meses de seguimento após a interrupção do tratamento com itraconazol por via oral.

Figura 4.

Após o tratamento, a úlcera superficial tornou‐se mais seca, com a formação de novo tecido de granulação; a crosta necrótica caiu e as secreções purulentas desapareceram.

(0,1MB).
Discussão

A infecção por Mucor irregularis ocorre principalmente em pacientes com fatores predisponentes, como diabetes, neoplasia, transplante de órgãos sólidos e trauma. No entanto, na maioria dos relatos de mucormicose por M. irregularis os pacientes não apresentavam imunodeficiência aparente.2 A paciente atual relatou ter sido picada por uma planta e não apresentava imunodeficiência de acordo com o exame de sangue. A aplicação sistemática de glicocorticoide, que causou a imunossupressão da paciente pouco antes de sua consulta, pode ter sido o gatilho para o agravamento da doença. As manifestações clínicas e a mortalidade devido à mucormicose cutânea dependem do modo de aquisição e do estado imunológico do hospedeiro. Esse fato destaca a importância de avaliar a história de uso de agentes imunossupressores.

K. pneumoniae é um patógeno piogênico Gram‐negativo bem conhecido; esse é um dos patógenos comunitários mais comuns, causando infecções oculares, cerebrais, pulmonares, hepáticas e geniturinárias. Ocasionalmente, K. pneumoniae pode dar origem a infecções cutâneas e de partes moles; a literatura apresenta relatos de fasciíte necrosante e infecção de partes moles, além de abscesso profundo e erupção cutânea purpúrica. A maioria dos casos relatados geralmente apresenta uma combinação de infecções cutâneas e de partes moles, complicadas. A infecção cutânea mista por M. irregularis e K. pneumoniae é extremamente rara.

O tratamento de infecções fúngicas invasivas é complicado, porque os alvos dos fármacos contra patógenos eucarióticos se assemelham aos do hospedeiro humano, o que limita as opções terapêuticas.3 A mucormicose cutânea primária resulta da inoculação direta de esporos de fungos na pele, cujas lesões resultantes podem imitar pioderma gangrenoso, gangrena bacteriana sinérgica ou outras infecções produzidas por bactérias ou fungos. Sua apresentação clínica altamente variável, os achados inespecíficos da infecção e a maior prevalência de outras condições infecciosas são responsáveis pelo atraso no diagnóstico da mucormicose cutânea. O quadro da paciente atual persistiu por dez anos desde o início até o diagnóstico.

O manejo nesses casos costuma ser desafiador, visto que o atraso no diagnóstico é um grande obstáculo para o tratamento precoce. Com base nas evidências disponíveis, AnB é o antifúngico empírico apropriado para a mucormicose invasiva, apresenta o maior espectro de atividade e suscetibilidade antifúngica. É prudente usar formulações lipossômicas ou outras estratégias para reduzir a nefrotoxicidade.3 Em comparação com AnB convencional, as formulações lipídicas da AnB são agora o tratamento de escolha e devem ser administradas por via intravenosa em dose mínima de 3‐5mg/kg/dia.4 No entanto, seu alto custo é uma restrição nos países em desenvolvimento e os pacientes geralmente não seguem o curso completo do tratamento. Embora M. irregularis seja menos suscetível ao fluconazol e ao itraconazol, o sucesso do tratamento da mucormicose cutânea com esses antifúngicos tem sido relatado na literatura.5 De acordo com os resultados da cultura de bactérias, o manejo da presente paciente foi feito com itraconazol oral e AnB lipossômica intravenosa, bem como cefoperazona/sulbactam sódica.

Em conclusão, apresentou‐se um caso raro de mucormicose cutânea primária causada por M. irregularis combinada com infecção cutânea por K. pneumoniae. Além da dificuldade do manejo de infecções fúngicas invasivas, ainda é necessário estar atento à possibilidade de infecção bacteriana cutânea concomitante.

Suporte financeiro

Nenhum.

Contribuição dos autores

Siping Zhang: Análise estatística; aprovação da versão final do manuscrito; concepção e planejamento do estudo; redação e edição do manuscrito; coleta, análise e interpretação de dados; participação no desenho do estudo; participação intelectual na conduta propedêutica e/ou terapêutica dos casos estudados; revisão crítica da literatura.

Kunju Zhu: Análise estatística; aprovação da versão final do manuscrito; redação e edição do manuscrito; participação no desenho do estudo; revisão crítica da literatura; revisão crítica do manuscrito.

Zhang Chi: Aprovação da versão final do manuscrito; redação e edição do manuscrito; coleta, análise e interpretação de dados; participação no desenho do estudo; participação intelectual na conduta propedêutica e/ou terapêutica dos casos estudados; revisão crítica da literatura; revisão crítica do manuscrito.

Conflitos de interesse

Nenhum.

Referências
[1]
M.D. Moen, K.A. Lyseng-Williamson, L.J. Scott.
Liposomal amphotericin B: a review of its use as empirical therapy in febrile neutropenia and in the treatment of invasive fungal infections.
[2]
X.J. Xia, H. Shen, Z.H. Liu.
Primary cutaneous mucormycosis caused by Mucor irregularis.
Clin Exp Dermatol., 40 (2015), pp. 875-878
[3]
T.T. Riley, C.A. Muzny, E. Swiatlo, D.P. Legendre.
Breaking the mold: a review of mucormycosis and current pharmacological treatment options.
Ann Pharmacother., 50 (2016), pp. 747-757
[4]
G.L. Petrikkos.
Lipid formulations of amphotericin B as first‐line treatment of zygomycosis.
Clin Microbiol Infect., 15 (2009), pp. 87-92
[5]
Y. Zhao, Q. Zhang, L. Li, J. Zhu, K. Kang, L. Chen.
Primary cutaneous mucormycosis caused by Rhizomucor variabilis in an immunocompetent patient.
Mycopathologia., 168 (2009), pp. 243-247

Como citar este artigo: Zhang S, Zhu K, Zhang C. Successful treatment of a patient with cutaneous co‐infection caused by Mucor irregularis and Klebsiella pneumoniae. An Bras Dermatol. 2020. https://doi.org/10.1016/j.abd.2020.03.004

Trabalho realizado no Departamento de Dermatologia e Venereologia, Primeiro Hospital Afiliado do USTC, Universidade de Ciência e Tecnologia da China, Hefei, Anhui, China.

Idiomas
Anais Brasileiros de Dermatologia (Portuguese)

Receba a nossa Newsletter

Opções de artigo
Ferramentas
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.